AmpliCHECK - Amplicon Sequencing CHECKing tool

		
AmpliCHECK is intended for a preliminary analysis of amplicon sequencing results.


		Before optimizing parameters for accurate genotyping, we should know the length, coverage and frequency
		of the most abundant variants in each amplicon and the potential erroneous ones (artefacts derived from
		sequencing or PCR errors).
		

AmpliCHECK de-multiplexes reads and performs a fast analysis of the higher
		frequency variants in each individual amplicon retrieving the previously mentioned information.


		After running AmpliCHECK we should be able to establish the length of the desired PCR products (markers),
		the % of errors in  variants and a threshold frequency to decide if a variant is real or is an artefact.
		


	
		
AmpliCHECK workflow schema

		Click to enlarge
		

		

		
AmpliCHECK takes as input:
		
    
		
  • SEQUENCE FILE: FASTQ or FASTA format file (compressed or uncompressed). Multiple sample/amplicon sequence files should be packed into a unique .ZIP or .TAR.GZ file. Also previously analyzed results can be used as input in AmpliSAS format Excel file.
    • 
		
  • AMPLICON DATA 1: primer and tag information in a CSV format file as explained in the documentation.
    • 
		

		      1 This file is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format.

		

		
An optional FASTA file with custom allele names and sequences can be provided.


		Results can be downloaded on the same page or from an email message after analysis completion.


		Results include an Excel file with three spreadsheets, the first includes coverage values, the second, amplicon frequencies and the third, potential sequencing errors and chimeras annotations.
		In every spreadsheet, true sequences are colored in green, questionable ones in yellow and clear artefacts in red.
		


		For more information, read the documentation.
		

		

	

		

		
Run AmpliCHECK

		

		

		
Run name: 

		
Email (optional): 

		

		

			Sequence file:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name

			If reads have been already de-multiplexed into separate files (one file per sample), 
			you can pack them into a single .zip or .tar.gz format file and use it as input.
			In such case you should leave empty the amplicon data section.

			Max. 500 MB 
			Download example

					
		

		

		

			Technology: 
			
			Auto
			Illumina
			454/IonTorrent
			     Analysis parameters will be optimized for the selected sequencing technology, they can be modified in "Advanced options".




			
If transcriptomic data is being analyzed or many co-amplifying alleles are expected (>10, e.g. MHC class I),
			the 'minimum per amplicon frequency' threshold in 'Advanced program parameters' section should be manually adjusted.
 
					
		

		

			Expand results: 
			
			If selected this option, the results will be printed in 3 spreadsheets (depths, frequencies and errors).
		

		

		

			Amplicon data:
			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).


			
			
or file: Max. 100 KB 
			See example

			


			
		
		

			Alleles file (optional):
			FASTA format Max. 2 MB 
			 See example

					
		

		

		

		
		

			
			Advanced program parameters


			
		

		


				
		
		
		

		

	

			
		
				

	
Disclaimer



		Your use of any of these tools is at your own risk.
		We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise).
		Access to these data is available free of charge for ordinary use in the course of research.
		By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.