AmpliMIX - Amplicon Sequencing MIXing tool

		
AmpliMIX combines amplicon sequencing data from two different experiments/runs that share common tag sequences and/or common samples.


		If different experiments have been carried out and their sequenced data need to be combined and analyzed
		together, the tool AmpliMIX will unify the reads into a unique dataset and will generate new unique tag
		sequences in case of redundancy.

		

		
AmpliMIX requires input data from two experiments:

		
    
		
  • SEQUENCE FILE A *: reads from the experiment A in FASTQ or FASTA format file (compressed or uncompressed)
    • 
		
  • AMPLICON DATA A: primer and tag information for 'Sequence file A' in a CSV format file as explained in the documentation.
    • 
		
  • SEQUENCE FILE B *: reads from the experiment B in FASTQ or FASTA format file (compressed or uncompressed)
    • 
		
  • AMPLICON DATA B: primer and tag information for 'Sequence file B' in a CSV format file as explained in the documentation.
    • 
		

		      * This tool CANNOT use as input multiple sequence files packed into a unique .ZIP or .TAR.GZ file.

		

		

		Results can be downloaded on the same page or from an email message after analysis completion.


		Output files will be in CSV and FASTA or FASTQ (depending of the input file) compressed format, ready to be used in other AmpliSAT tools like AmpliCHECK or AmpliSAS.
		


		For more information, read the documentation.
		

	

		

		
Run AmpliMIX

		

		

		
Run name: 

		
Email (optional): 

		

			
Experiment A data: 

		

		

			

		

		

			Sequence File A:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name
 Max. 500 MB 
			Download example

					
		

		

			Amplicon data A:
			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).


			
			
or file: Max. 100 KB 
			See example

			


			
		
		

			
Experiment B data: 

		

		

			

		

		

			Sequence File B:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name
 Max. 500 MB 
			Download example

					
		

		

			Amplicon data B:
			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).


			
			
or file: Max. 100 KB 
			See example

			


			
		
		



				
		
		
		


	

			
		
				

	
Disclaimer



		Your use of any of these tools is at your own risk.
		We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise).
		Access to these data is available free of charge for ordinary use in the course of research.
		By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.