AmpliTAXO - Amplicon Sequencing TAXOnomy and OTU assignment tool

		
AmpliTAXO analyzes metagenomics data by performing sequence clustering and taxonomic assignments.


		Amplicon sequencing data is automatically processed using AmpliSAS algorithm.

		Operational Taxonomic Units (OTUs) are retrieved and taxonomic assignments are performed comparing OTUs representative sequences against the most popular metagenomics databases or user provided data.

		

		

AmpliTAXO workflow schema

		

		

		
AmpliTAXO takes as input:
		
    
		
  • SEQUENCE FILE: FASTQ or FASTA format file (compressed or uncompressed). Multiple sample/amplicon sequence files should be packed into a unique .ZIP or .TAR.GZ file. Also previously analyzed results can be used as input in AmpliSAS format Excel file.
    • 
		
  • AMPLICON DATA 1: primer and tag information in a CSV format file as explained in the documentation.
    • 
		
  • REFERENCE DATABASE 2: FASTA file with sequences and headers including taxonomy annotations in UTAX format. For more details read the documentation.
    • 
		

		      1 This file is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format.

		      2 Only in case you do not want to use any of the reference databases available below.

		

		Several sets of primers can be used for different regions of the same barcoding gene (e.g. hypervariable nuclear ribosomal RNA regions). In fact it is encouraged to amplify multiple regions to obtain accurate and unambiguous assignments. Other markers can be used if the user provides reference sequences in UTAX format.


		An Excel file will be generated with analysis results, two spreadsheets per locus, first one with allele frequencies and second one with expanded redundant allele assignations of high precission genotypes.


		Results can be downloaded on the same page or from an email message after analysis completion.


		For more information, read the documentation.
		

		

	

	
	

		
Run AmpliTAXO

		

		

		
Run name: 

		
Email (optional): 

		


		

			Sequence file:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name

			If reads have been already de-multiplexed into separate files (one file per sample), 
			you can pack them into a single .zip or .tar.gz format file and use it as input.
			In such case you should leave empty the amplicon data section.

			Max. 500 MB 
			Download example

					
		

		

		

			Technology: 
			
			Illumina
			454/IonTorrent (slow)
			Auto (slow)
			     Analysis parameters will be optimized for the selected sequencing technology.

					
		

		


		

			Amplicon data:
			This field is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format.

			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).

			
			
			
or file: Max. 100 KB 
			See example

			


			
		
		

			Reference database: 
			
			SILVA-SSU1a
			SILVA-LSU1b
			UNITE2
			Greengenes3
			CORE4
			HOMD5
			


			1a Small Subunit rRNA Database (597607 entries, Version 123, July 23, 2015). It is based on the SILVA Ref dataset with a 99% criterion applied to remove redundant sequences using the UCLUST tool.

			Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–6 (2013). [Pubmed]

			1b Large Subunit rRNA Database (96642 entries, Version 123, July 23, 2015). This is the LSU reference database containing only high quality, aligned 23S/28S ribosomal RNA sequences with a minimum length of 1900 bases.

			Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–6 (2013). [Pubmed]

			2 UNITE general release (22770 entries, Version 7, August 1, 2015). UNITE is a a high quality and reliable database of rDNA sequences for fungi identification.

			Kõljalg, U. et al. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 22, 5271–7 (2013). [Pubmed]

			3 Greengenes chimera-checked 16S rRNA gene database 90 percent non redundant core set (4799 entries, May 9, 2011).

			DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069–72 (2006). [Pubmed]

			4 CORE (core oral microbiome) 16S rDNA database (1262 entries, January 28, 2014).

			Griffen, A. L. et al. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome. PLoS One 6, e19051 (2011). [Pubmed]

			5 HOMD (Human Oral Microbiome Database) 16S rDNA reference sequences (831 entries, Version 13.2).

			Chen, T. et al. The Human Oral Microbiome Database: a web accessible resource for investigating oral microbe taxonomic and genomic information. Database (Oxford). 2010. [Pubmed]

			

					
		

		

			
			FASTA file with taxonomic annotations in UTAX format Max. 200 MB 
			 See example

			

			If a FASTA file is provided, the sequences and taxonomic annotations from this file will  be used instead of the previous databases.
					
		

		


		

		

		
		

			
			Advanced program parameters


			
		

		


				
		
		
		

	

			
		
			
	

	

	I develope this tool in my free time without any academic/commercial support, I will be grateful if you want to contribute:

	
	
	
	
	

	

	
	

	
Disclaimer



		Your use of any of these tools is at your own risk.
		We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise).
		Access to these data is available free of charge for ordinary use in the course of research.
		By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.