AmpliCLEAN - Amplicon Sequencing CLEANing tool

		
AmpliCLEAN filters reads not belonging to any amplicon and removes low quality and/or anomalous short/long ones.



		Sequenced data may contain reads from other experiments (sequenced together,
		usually to decrease costs), and low quality or abnormally short/long ones that it is recommended to remove
		before continuing further analysis to save disk space and time. For this purpose, AmpliCLEAN will separate
		experiment-specific reads complying the desired length and quality parameters.
		
		

		
AmpliCLEAN takes as input::

		
    
		
  • SEQUENCE FILE: FASTQ or FASTA format file (compressed or uncompressed). Multiple sequence files should be packed into a unique .ZIP or .TAR.GZ file.
    • 
		
  • AMPLICON DATA *: primer and tag information in a CSV format file as explained in the documentation.
    • 
		

		      * This file is not required if the 'Sequence File' already contains multiple files packed together.

		

		Results can be downloaded on the same page or from an email message after analysis completion.


		Output file will be in FASTA or FASTQ (depending of the input file) compressed format, ready to be used in other AmpliSAT tools like AmpliCHECK or AmpliSAS.
		


		For more information, read the documentation.
		

	

		

		
Run AmpliCLEAN

		

		

		
Run name: 

		
Email (optional): 

		

		

			Sequence file:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name

			If reads have been already de-multiplexed into separate files (one file per sample), 
			you can pack them into a single .zip or .tar.gz format file and use it as input.
			In such case you should leave empty the amplicon data section.

			Max. 500 MB 
			Download example

					
		

		

		

			Amplicon data:
			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).


			
			
or file: Max. 100 KB 
			See example

			


			
		
		

		

			Minimum Phred quality score: 
			
			Reads/sequences with lower average Phred quality score will be removed. Only Sanger/Phred+33 encoding format is supported.
		

		

			Minimum sequence length: 
			
			Reads/sequences with lower lengths will be removed.
		

		

			Maximum sequence length: 
			
			Reads/sequences with higher lengths will be removed.
		

		

			Trim sequence length: 
			
			Reads/sequences will be trimmed to the desired length.
		

		

			Maximum number of reads per amplicon: 
			
			Maximum number of amplicon sequences/reads to be processed.
		

		



				
		
		
		

	

			
		
				

	
Disclaimer



		Your use of any of these tools is at your own risk.
		We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise).
		Access to these data is available free of charge for ordinary use in the course of research.
		By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.