AmpliHLA - Amplicon Sequencing HLA typing tool

AmpliHLA performs HLA typing of amplicon sequencing data.

Amplicon sequencing data is automatically processed using AmpliSAS algorithm.
HLA alleles are annotated comparing genotyped variants against the genomic and cDNA sequences from the IMGT/HLA database.

AmpliHLA has been developed for research purposes and it is not intended for human diagnosis.

AmpliHLA takes as input:

SEQUENCE FILE: FASTQ or FASTA format file (compressed or uncompressed). Multiple sample/amplicon sequence files should be packed into a unique .ZIP or .TAR.GZ file. Also previously analyzed results can be used as input in AmpliSAS format Excel file.
AMPLICON DATA ¹: primer and tag information in a CSV format file as explained in the documentation.

¹ This file is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format.

Several markers can be used for the same locus, ex. 2 or more markers for exons 2 and 3. In fact it is encouraged to obtain accurate and unambiguous genotypes.

An Excel file will be generated with genotyping results and expanded redundant allele assignations of high precission genotypes.

Results can be downloaded on the same page or from an email message after analysis completion.

For more information, read the documentation.

Run AmpliHLA

Run name:
Email (optional):

Data type:	Amplicons¹ RNA-Seq² Exome-Seq² ¹ Reads will be de-multiplexed, clustered, filtered by the AmpliSAS algorithm and at the end mapped to HLA references as explained by Sebastian et al. [Pubmed] ² Reads will be first mapped to HLA references and the best-mapping alleles will be selected for haplotypes with a modified version of the Boegel et al. protocol [Pubmed] Analysis parameters will vary depending of the chosen typing method.

Sequence file:	FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name If reads have been already de-multiplexed into separate files (one file per sample), you can pack them into a single .zip or .tar.gz format file and use it as input. In such case you should leave empty the amplicon data section. Max. 500 MB Download example Or file URL:

Technology:	Auto Illumina 454/IonTorrent Analysis parameters will be optimized for the selected sequencing technology.

Alleles:	IMGT/HLA database (17375 sequences; Last update: 22 November 2023; Download).

Amplicon data:	This field is not required if the 'Sequence File' already contains sample/amplicon files packed together (already de-multiplexed) or it is an Excel file in AmpliSAS format. It is very important to specify all the primer and tag sequences in 5'->3' sense. Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA). >marker,primer_f,primer_r,gene,feature,specie HLA_A2,CRGGTCTCAGCCACTSCTC,CTCGGACCCGGAGACTGT,HLA-A MHC class I,exon 2,Homo sapiens HLA_A3,CTYGGGGGACYGGGCTGAC,CCCAATTGTCTCCCCTCCTTG,HLA-A MHC class I,exon 3,Homo sapiens HLA_B2,GGSAGGGAAATGGCCTCT,GGATGGGGAGTCGTGACCT,HLA-B MHC class I,exon 2,Homo sapiens HLA_B3,GCGTTTACCCGGTTTCATT,CGGCGACCTATAGGAGATGG,HLA-B MHC class I,exon 3,Homo sapiens >sample,tag_f C1Rneo,GTCGTA Daudi,AAGCGA HEK293,TGTCTC NCI_H929,GGTGCT Raji,TGCGAG or file: Max. 100 KB See example

Advanced program parameters

AmpliHLA has been developed for research purposes and it is not intended for human diagnosis.

Disclaimer

Your use of any of these tools is at your own risk. We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.


Analysis parameters:
Leave in blank if you don't want to use the parameter.
Minimum alignment (%):	%. Minimum sequence percentage required to align to a reference to be annotated.
Minimum identity (%):	%. Minimum percentage of the aligned fragment required to be identical to a reference to be annotated.
Minimum amplicon frequency (%):	%. Unique sequences with lower frequency will be discarded.
Identity threshold (%):	%. Unique sequences with equal or higher identity will be grouped together. If this value is left empty (recommended), sequences will be clustered according to sequencing error rates.
Keep singletons:	Keep singletons (variants with coverage 1) after clustering.
Minimum amplicon depth:	Amplicons with lower total coverage will be discarded.
Maximum number of reads per amplicon:	Maximum number of amplicon sequences/reads to be processed.
Discard chimeras:	Sequences that are chimeras from other major sequences will be discarded.

Sequence/reads file:	FASTQ (compressed or uncompressed) Max. 500 MB Download: RNA-Seq example, Exome-Seq example Or file URL: (RNA-Seq example: ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR387/SRR387401/SRR387401_1.fastq.gz)

Paired-end reads file (optional):	FASTQ (compressed or uncompressed) Max. 500 MB Download: RNA-Seq example, Exome-Seq example Or file URL: (RNA-Seq example: ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR387/SRR387401/SRR387401_2.fastq.gz)

Alleles:	RNA-Seq alleles (6403 sequences; Download). Exome-Seq alleles (9400 sequences; Download).