AmpliLEGACY - Amplicon Sequencing LEGACY genotyping methods

		
AmpliLEGACY emulates previously published methods for genotyping amplicon sequencing data.


		Three genotyping protocols (Sommer et al. 2013; Radwan & Herdegen et al. 2014; Lighten et al. 2014) have been automated in this tool.


		Though we encourage the use of AmpliSAS
		because it has already showed excellent results in error correction and genotyping of Illumina, 454 and Ion Torrent data (Sebastian et al. 2015),
		these alternative genotyping strategies are equally valid if they are used with the same NGS technology and experimental requirements specified in their original articles.

		


		
AmpliLEGACY takes as input 1:

		
    
		
  • SEQUENCE FILE 2: reads from the experiment in a FASTQ or FASTA format file (compressed or uncompressed).
    • 
		
  • AMPLICON DATA: primer and tag information in a CSV format file as explained in the documentation.
    • 
		

		      1 Sommer method requires additional data from a replicate experiment including identical marker and sample names (tags can be different).

		      2 This tool CANNOT use as input multiple sequence files packed into a unique .ZIP or .TAR.GZ file.

		

		

		Results can be downloaded on the same page or from an email message after analysis completion with a similar format than AmpliSAS ones.
		


		For more information, read the documentation.
		

	

		

		
Run AmpliLEGACY

		

		

		
Run name: 

		
Email (optional): 

		

		

			Sequence file:
			FASTA/FASTQ (compressed or uncompressed) without spaces, parenthesis or other special symbols in the name
 Max. 500 MB 
			Download example

					
		

		

		

			Genotyping method: 
			
				
				Sommer et al.1
				Lighten et al.2
				Radwan & Herdegen et al.3,4
				


				1 Sommer S, Courtiol A, Mazzoni CJ. MHC genotyping of non-model organisms using next-generation sequencing: a new methodology to deal with artefacts and allelic dropout. BMC Genomics. 2013 Aug 9;14:542. [Pubmed]

				2 Lighten J, van Oosterhout C, Paterson IG, McMullan M, Bentzen P. Ultra-deep Illumina sequencing accurately identifies MHC class IIb alleles and provides evidence for copy number variation in the guppy (Poecilia reticulata). Mol Ecol Resour. 2014 Jul;14(4):753-67. [Pubmed]

				3 Radwan J, Zagalska-Neubauer M, CichoĊ„ M et al. MHC diversity, malaria and lifetime reproductive success in collared flycatchers. Mol Ecol. 2012 May;21(10):2469-79. [Pubmed]

				4 Herdegen M, Babik W, Radwan J. Selective pressures on MHC class II genes in the guppy (Poecilia reticulata) as inferred by hierarchical analysis of population structure. J Evol Biol. 2014 Nov;27(11):2347-59. [Pubmed]

				

					
		

		

		

			Minimum amplicon depth: 
			
			Amplicons with lower total coverage will be discarded.
		

		

		

			Amplicon data:
			It is very important to specify all the primer and tag sequences in 5'->3' sense.
Shortening primer sequences to 7-9 nts can increase the number of retrieved sequences (eg. GAGTGTCAT instead of GAGTGTCATTTCTCCAACGGGA).


			
			
or file: Max. 100 KB 
			See example

			


			
		
		

			Alleles file (optional):
			FASTA format Max. 2 MB 
			 See example

					
		

		

		

			Maximum number of reads per amplicon: 
			
			Maximum number of amplicon sequences/reads to be processed.
		

		

			Exact length required: 
			
			Only sequences that satisfy theoretical marker lengths can be 'dominant' within a cluster.
		

		

			In-frame length required: 
			
			Only sequences in-frame with marker theoretical lengths can be 'dominant' within a cluster.
		

		

		

		
		

		
		
		


				
		
		
		

		

	

			
		
				

	
Disclaimer



		Your use of any of these tools is at your own risk.
		We do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise).
		Access to these data is available free of charge for ordinary use in the course of research.
		By visiting the site, you accept our use of cookies and you accept that your data and results will be stored in our server.